IthaID: 2948
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs1799983 | HGVS Name: | NG_011992.1:g.12965T>G |
Context nucleotide sequence:
CCCTGCTGCTGCAGGCCCCAGATGA [G/T] CCCCCAGAACTCTTCCTTCTGCCCC (Strand: +)
Also known as: G894T
Comments: SNP associated with age onset of menarche in females with sickle cell disease from India (39 cases; 48 controls) [PMID: 23795274]. SNP (T allele) associated with higher hematocrit and haemoglobin levels in Greek patients with severe clinical course of SCD [PMID: 27871907]. SNP (GG genotype) associated with an increased reticulocyte count and high serum lactate dehydrogenase levels in pediatric SCA patients from Portugal [PMID: 27802215].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Delayed menarche [HP:0012569] Abnormal haematocrit [HP:0031850] Increased lactate dehydrogenase activity [HP:0025435] Reticulocytosis [HP:0001923] Anaemia [HP:0001903] |
Location
Chromosome: | 7 |
---|---|
Locus: | NG_011992.1 |
Locus Location: | 12965 |
Size: | 1 bp |
Located at: | NOS3 |
Specific Location: | Exon 8 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | Indian, Greek, Portuguese |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Nishank SS, Endothelial Nitric Oxide Synthase (eNOS) Gene Polymorphism is Associated with Age Onset of Menarche in Sickle Cell Disease Females of India., Mediterr J Hematol Infect Dis , 5(1), e2013036, 2013 PubMed
- Aguiar L, Matos A, Gil Â, Afonso C, Braga L, João L, Kjollerstrom P, Faustino P, Bicho M, Inácio Â, Sickle cell anemia - Nitric oxide related genetic modifiers of hematological and biochemical parameters., Clin. Hemorheol. Microcirc. , 2016 PubMed
- Armenis I, Kalotychou V, Tzanetea R, Kollia P, Kontogeorgiou Z, Anastasopoulou D, Mantzourani M, Samarkos M, Pantos K, Konstantopoulos K, Rombos I, Prognostic value of T786C and G894T eNOS polymorphisms in sickle cell disease., Nitric Oxide , 62(0), 17-23, 2017 PubMed
Created on 2016-08-09 14:34:02,
Last reviewed on 2019-12-23 11:21:31 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-08-09 14:34:02 | The IthaGenes Curation Team | Created |
2 | 2016-08-16 11:49:24 | The IthaGenes Curation Team | Reviewed. |
3 | 2016-09-12 15:17:31 | The IthaGenes Curation Team | Reviewed. Comment updated. Clinical phenotype added. |
4 | 2017-01-23 13:41:44 | The IthaGenes Curation Team | Reviewed. Mutation comment, clinical phenotype and other details sections updated. Reference added. |
5 | 2017-01-30 16:14:58 | The IthaGenes Curation Team | Reviewed. Clinical phenotype added. |
6 | 2017-01-31 12:36:17 | The IthaGenes Curation Team | Reviewed. Mutation comment, Clinical Phenotype and Other Info sections updated. Reference added. |
7 | 2017-01-31 12:37:25 | The IthaGenes Curation Team | Reviewed. Clinical Phenotype added. |
8 | 2019-07-03 15:57:28 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
9 | 2019-12-23 11:21:31 | The IthaGenes Curation Team | Reviewed. Clinical phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-30 12:06:09